Petroglifos. Revista Crítica Transdisciplinar 7(1):e070105 enero-junio 2024
ISSN: 2610-8186
https://petroglifosrevistacritica.org.ve/
Artículo Científico

Extracción de ADN en tejido foliar de Citrus latifolia con resina Chelex-100 para el diagnóstico molecular de Candidatus Liberibacter asiaticus

DNA extraction in Citrus latifolia leaf tissue with Chelex-100 resin for the molecular diagnosis of Candidatus Liberibacter asiaticus
1Profesional de Investigación, Laboratorio de Biología Molecular, Dirección de Agricultura y Soberanía Alimentaria, Fundación Instituto de Estudios Avanzados (IDEA), Carretera Hoyo De La Puerta - El Placer, Sector Sartenejas, Caracas 1080. Baruta, Venezuela.
2Personal de Investigación, Laboratorio de Biología Molecular, Dirección de Agricultura y Soberanía Alimentaria, Funda¬ción Instituto de Estudios Avanzados (IDEA), Carretera Hoyo de La Puerta - El Placer, Sector Sartenejas, Código postal: Caracas 1080. Baruta, Venezuela
3Profesional de Investigación, Instituto Nacional de Investigaciones Agrícolas (INIA), Av. Urdaneta Urb. El Encanto, Edificio INIA. Mérida, Venezuela
4Laboratorio de Biología y Medicina Experimental (LABIOMEX), Facultad de Ciencias, Universidad de los Andes (ULA), Av. Alberto Carnevalli, La Hechicera, Núcleo Universitario Pedro Rincón Gutiérrez, Edificio A., Av. Alberto Carnevali, Código postal: 5101. Mérida, Venezuela
*Correo electrónico: jdrr55@gmail.com
Recibido: 24/04/2024 Aceptado: 04/06/2024 Publicado: 29/06/2024
RESUMEN

En el presente trabajo, se presenta una metodología rápida y de bajo costo para la purificación de ADN genómico de Citrus latifolia, para ser usado en el diagnóstico molecular mediante la Reacción en Cadena de la Polimerasa (PCR) de Candidatus Liberibacter asiaticus (CLas), causante de la enfermedad comúnmente conocida como dragón amarillo. En Venezuela las plantaciones de cítricos han empezado a ser afectadas por el patógeno CLas, y en este trabajo se reporta la existencia del patógeno en los Andes venezolanos. El diagnóstico oportuno de la presencia de esta bacteria permitirá tomar medidas preventivas para evitar su expansión. Las muestras de hojas fueron recolectadas de plantas de Citrus latifolia, con signos morfológicos de infección por CLas, que procedían del Municipio Sucre, estado Mérida, Venezuela. a extracción de ADN genómico con Chelex-100 (Chelating Ion Exchange Resin) produjo un ADN óptimo que fue utilizado como molde para las amplificaciones de PCR. El método permitió la detección del ADN del patógeno y por su sencillez contribuyó con el análisis rápido de un elevado número de muestras, resultando por lo tanto muy conveniente en el diagnóstico molecular. El procedimiento de extracción de ADN genómico del tejido vegetal utilizando la resina Chelex-100 requirió de un solo paso, con un mínimo de manipulación, no utiliza compuestos tóxicos y permite eliminar una gran proporción de inhibidores que dificultan la reacción de PCR.

Palabras clave: Biología molecular, Candidatus Liberibacter asiaticus, Citrus latifolia, Huanglongbing (HLB), Reacción en Cadena de la Polimerasa (PCR)
ABSTRACT

This paper presents a rapid and low-cost methodology for the purification of genomic DNA from Citrus latifolia, to be used in the molecular diagnosis by Polymerase Chain Reaction (PCR) of Candidatus Liberibacter asiaticus (CLas), the cause of the disease commonly known as yellow snapdragon. In Venezuela, citrus plantations have begun to be affected by the pathogen CLas, and this work reports the existence of the pathogen in the Venezuelan Andes. Timely diagnosis of the presence of this bacterium will allow preventive measures to be taken to avoid its spread. Leaf samples were collected from Citrus latifolia plants with morphological signs of CLas infection from the Sucre Municipality, Mérida State, Venezuela. Genomic DNA extraction with Chelex-100 (Chelating Ion Exchange Resin) produced optimal DNA that was used as a template for PCR amplifications. The method allowed the detection of pathogen DNA and due to its simplicity contributed to the rapid analysis of a large number of samples, thus being very convenient in molecular diagnosis. The procedure for extraction of genomic DNA from plant tissue using Chelex-100 resin required only one step, with a minimum of manipulation, does not use toxic compounds and allows elimination of a large proportion of inhibitors that hinder the PCR reaction.

Key words: Candidatus Liberibacter asiaticus, Citrus latifolia, Huanglongbing (HLB), Molecular biology, Polymarase chain reaction (PCR)

Introducción

El microorganismo Candidatus Liberibacter asiaticus (CLas) es causante de la enfermedad conocida como Huanglongbing (HLB) o dragón amarillo y afecta diversas especies de plantas del género Citrus (Jagoueix et al., 1994; Marys et al., 2020), entre las que se encuentran el limón, la naranja y la mandarina. El diagnóstico de plantas infectadas en fases tempranas es de suma importancia para el control del patógeno. Las técnicas moleculares, como la Reacción en Cadena de la Polimerasa (PCR), ofrecen una detección e identificación rápida y específica en ensayos de diagnóstico molecular (Hocquellet et al., 1999). Sin embargo, la purificación a gran escala del ADN genómico es laborioso y costoso, y normalmente se utilizan para su extracción, estuches comerciales o el método de extracción que utiliza Cetil trimetil bromuro de amonio (CTAB)  (Fourie et al., 2020, Donnua et al., 2012).

En Venezuela la detección de este microorganismo data de 2017 (Marys et al., 2020) y es común su presencia en plantaciones de naranja (Citrus sinensis) y mandarina (Citrus reticulata) en los estados: Aragua, Carabobo, Miranda, Portuguesa y Yaracuy. Hasta el momento, no existían casos reportados de la enfermedad del Dragón Amarillo en el estado Mérida; no obstante, en plantaciones de limón Persa (Citrus latifolia), se han detectado plantas con los síntomas característicos de la enfermedad tales como: hojas amarillentas, ramas secas y frutos con coloración anormal (Robles-González et al., 2012). En este trabajo se presenta un método eficiente y rápido de extracción de ADN genómico total a partir de hojas, que permite la detección por PCR de CLas, verificando la existencia del patógeno en el tejido foliar proveniente de plantas de dicha localidad.

El método para la extracción de ADN que utiliza la resina Chelex-100 ha resultado ser eficiente en patógenos virales acuáticos (Eismann et al., 2023);  estudios meta genómicos de bacterias (Graham et al., 2023); animales acuáticos (Hu et al., 2022);  de Candida sp. (Lim et al., 2022); análisis de muestras de ADN humano para estudios forenses (Neves y Zieger., 2023; Simon et al., 2020); identificación de especies de mariscos (Rodriguez-Riveiro et al., 2022); determinación de genes de resistencia a drogas en Enterobacteriaceae (Tao et al., 2022); identificación de hongos patógenos de plantas (Xu et al., 2023); estudios genéticos de plantas de tomate (Aminisarteshniz et al., 2022), de semillas de arroz  (Ashfaqur Sajib et al., 2017), de Candidatus Liberibacter Solanacearum en Psílido (Quintana et al.,2022) y de algas (HwangBo et al., 2010).

La resina Chelex 100 es un copolímero de estireno divinilbenceno que contiene iones de iminodiacetato emparejados, los cuales actúan como grupos quelantes en la unión de iones metálicos polivalentes como cobre, hierro y magnesio y, por lo tanto, inhibe la actividad de DNAsa, permitiendo por lo tanto la extracción de ADN en extractos libres de células, además no es un compuesto tóxico (Butler, 2005).

Las extracciones con la resina Chelex-100, generan cantidades suficientes de ADN para estudios moleculares, a través de técnicas tales como: PCR, Amplificación Isotérmica de Bucle de la Polimerasa (LAMP) y Reacción en Cadena de la Polimerasa en tiempo real (qPCR) (Graham et al., 2023; Hu et al., 2022.; Lim et al., 2022).

Por lo anteriormente expuesto, se planteó como objetivo de este trabajo establecer un protocolo de purificación de ADN genómico utilizando la resina Chelex-100 para ser usado en el diagnóstico molecular de CLas en Citrus latifolia.

Materiales y Métodos

Procedimiento de extracción de ADN

La metodología propuesta de extracción de ADN con Chelex-100 Bio-Rad al 5 % en H2O ultra pura, se realizó en un tiempo aproximado de 15 min. Las muestras de plantas con síntomas de la enfermedad del Dragón Amarillo (hojas con apariencia clorótica con manchas amarillentas y con moteado asimétrico) provinieron del municipio Sucre del estado Mérida (coordenadas geográficas: 8° 30′ 30″ Norte, 71° 23′ 13″ Oeste).

Se utilizó el tejido foliar de tres plantas, tres extracciones independientes para cada planta y rindieron un total de nueve extracciones. Los fragmentos de hojas con nervaduras de 2 mg y con un diámetro de 0,5 cm, se maceraron durante 1 min con 500 µL de resina Chelex-100 Bio-Rad, al 5 %. A continuación, la mezcla se transfirió a un tubo de 1,5 mL y se agitó en vortex, por 10 s. Se incubó a 100°C durante 5 min, luego se agitó en vortex durante 10 s, y se centrifugó a 12000 rpm durante 1 min. Se utilizaron entre 1-2 µL del sobrenadante obtenido como molde para la amplificación por PCR. Los experimentos fueron realizados en el Laboratorio de Biología Molecular de la Dirección de Agricultura y Soberanía Alimentaria (ASA) de la Fundación Instituto de Estudios Avanzados (IDEA).

Cuantificación de ADN

La cantidad de ADN obtenido se determinó utilizando un espectrofotómetro Eppendorf; BioPhotometer Modelo #6131 (Westbury, USA), con alícuotas de 50 µL del sobrenadante, midiendo las A260 nm y A280 nm.

Oligonucleótidos iniciadores y condiciones de la PCR

Se utilizaron oligonucleótidos específicos para el ribosoma 28S de plantas, con las designaciones y secuencias de 28C: (GCTATCCTGAGGGAAACTTC) (Keith et al., 1988) y 28New: (TCTGACATGTGTGCGAGTCAAC) reportado por Richero (2012). La amplificación con estos oligonucleótidos, originó un fragmento de 305 pb y sirvió como un control de extracción de ADN genómico del tejido vegetal. La detección del patógeno, se evidencio en reacciones de amplificación con los oligonucleótidos específicos para el gen DKG de CLas DKG-F (GATGGTATTTTCTTTTCGGAGACCTTTACA) y DKG-R: (ATCACCGGCAGTCCCTATAAAGTACCCAACATCTA), los cuales amplificaron un fragmento de 170 pb (Ghosh et al., 2018).

Los componentes para la PCR fueron: Tris-HCl 20 mM a pH= 8, MgCl2 2,5 mM,  dNTPs 0,1 mM, oligonucleotidos 0,2 µM y 1U/µL de ADN polimerasa de Thermus aquaticus, 2 µL de ADN genómico y agua ultra pura para un volumen final de 20 µL. Ambas amplificaciones se realizaron en un Termociclador; Mastercycler® ep, EPPENDORF, según un procedimiento que consistió de un ciclo inicial de desnaturalización de 95°C por 4 min, seguido de 35 ciclos de desnaturalización de 95°C por 1 min, 35 ciclos de alineamiento de 48°C por 2 min y una extensión final de 72°C  por 10 min.

Electroforesis y visualización de productos de PCR

Los fragmentos amplificados se evidenciaron mediante electroforesis en geles de agarosa (D-1 LE GQT, Scientific Trade Corp) al 2 %, a 90 V durante 45 min en una cámara horizontal BIORAD. Se corrieron 5 µL de la mezcla de reacción por canal. En las electroforesis se incluyó un marcador de 100 pb de bases Invitrogen.  Una vez culminada la corrida electroforética el gel se incubó con SYBR Green Bio-Rad, diluido 1/10000; y las bandas de ADN se visualizaron con luz ultravioleta y fueron registradas en un digitalizador de imágenes UVITEC 4.1 Cambridge.

Resultados y Discusión

En el cuadro 1 se presentan los valores de los cocientes de absorbancia A260/A280  obtenidos y comprendidos entre 0,7 y 0,9. Este coeficiente se utiliza para evaluar la pureza de la muestra de ADN, por lo que valores entre 1,8 y 2,0 son considerados como muestras de pureza óptima. Cuando el valor del cociente de A260/A280 es inferior a 1,6; indican una posible contaminación con compuestos fenólicos o proteínas, mientras que valores superiores a 2,1 son consecuencia de la presencia de ARN (Lucena et al., 2016). Por lo tanto, los valores del cociente A260/A280 obtenidos en este trabajo sugirieron la presencia de proteína en la muestra.

Cuadro 1

Cuantificación espectrofotométrica del contenido de ADN de 2 mg de tejido vegetal, mediante el cociente de absorbancias A260/A280.

MuestraA260/A280[ADN] (ng. µL-1)
10,9035
20,9151
30,8514
40,8112
50,8411
60,8316
70,7422
80,8417
90,8623

 La cuantificación se hizo a tres extracciones independientes para cada una de las plantas con signos morfológicos de infección por CLas. Las muestras 1, 2 y 3 corresponden a la planta 1, las muestras 4, 5 y 6 corresponden a la planta 2, y las muestras 7, 8 y 9 corresponden a la planta 3. Se observó un mejor rendimiento en función a la cantidad de tejido vegetal y concentración del ADN obtenido en las muestras de la planta 3, seguido por las muestras de la planta 2. Es importante destacar, que el valor de 51 ng.µL-1 de la muestra 2 y que corresponde a la planta 1, pudo ser un error al momento de la toma de dicha muestra con la micropipeta.

En la figura 1 se muestra el gel de agarosa del ADN extraído de tejido vegetal, evidenciándose la presencia de ácido nucleico con el procedimiento utilizado. No se detectó la presencia de ARN en ninguna de las extracciones, lo que constituyó una característica conveniente del método en estudio.

Figura 1

Gel de agarosa del ADN genómico de plantas de limón Persa.

<em><noscript><img width=

Nota. Se muestran tres extracciones independientes para cada una de las plantas. Canales 1, 2 y 3: planta 1. Canales 4, 5 y 6: planta 2. Canales 7, 8 y 9: planta 3. PM: Marcador 1 kb Step Ladder Invitrogen con diez fragmentos de ADN con extremos romos que van desde 1 kb a 10 kb en incrementos de 1 kb. La flecha indica el ADN genómico.

 

Asimismo, en la figura 2 se muestra el gel de agarosa de las amplificaciones con los oligonucleótidos para el marcador molecular 28S de plantas. Aunque todas las extracciones de ADN rindieron muestras con cocientes A260/A280 menores a 1, las mismas sirvieron de molde en la obtención de una banda de 305 pb en todas las muestras, confirmándose la presencia del amplificado 28S ribosomal.

Figura 2

Gel de agarosa al 2% de las amplificaciones con los oligonucleótidos específicos para el marcador 28S ribosomal de plantas.

<em><noscript><img width=

Nota. Canales 1, 2 y 3: Planta 1. Canales 4, 5 y 6: Planta 2. Canales 7, 8 y 9: Planta 3, Canal 10: Control positivo. Canal 11: Control negativo (amplificación sin molde). PM: Marcador de peso molecular de ADN de 100 pb Invitrogen. La flecha indica la banda de amplificación de 305 pb.

 

En la figura 3 se muestra el gel de agarosa hecho con las muestras provenientes de la amplificación con los oligonucleótidos específicos para el gen DKG de CLas. Todas las muestras produjeron una banda de 170 pb, lo que indicó la presencia del patógeno. Esto constituye la primera evidencia molecular, hasta donde se conoce, de la existencia de la enfermedad del Dragón Amarillo en la región de los Andes Venezolanos. Las muestras 1, 6 y 7 mostraron bandas correspondientes a los dímeros de oligonucleótidos. Este resultado reflejó la dificultad que existió para la amplificación del gen específico de CLas, lo que sugiere que no está distribuido de forma homogénea dentro de la hoja, por lo que harían falta varias réplicas para asegurar su amplificación.

Figura 3

Gel de agarosa al 2% de las reacciones de amplificación con los oligonucleótidos específicos para el fragmento del gen DKG de 170 pb de Candidatus Liberibacter asiaticus.

Gel de agarosa al 2% de las amplificaciones con los oligonucleótidos específicos para el marcador 28S ribosomal de plantas

Nota. Canales 1, 2 y 3: Planta 1. Canales 4, 5 y 6: Planta 2. Canales 7, 8 y 9: Planta 3. Canal 10: Control positivo (Planta previamente diagnosticada). Canal 11: Control negativo (amplificación sin molde). PM: Marcador de peso molecular de 100 pb de ADN Invitrogen. La flecha indica la banda de amplificación del fragmento de 170 pb. Se observan posibles dímeros de los oligos por debajo de los 100 pb.

 

Es importante destacar, que los protocolos clásicos de extracción de ADN genómico utilizan solventes tóxicos como cloroformo y fenol, otros métodos incluyen la utilización de etanol o isopropanol, proteínasa K e incubación a bajas temperaturas (-20ºC) sumergiendo en nitrógeno líquido, requiriéndose también la transferencia de la muestra a varios tubos durante la purificación del ADN genómico (Stacey et al., 2000).  Al utilizar la resina Chelex-100 se evita el uso de alcoholes, compuestos tóxicos y sólo se utiliza un tubo para obtener el ADN genómico.

La extracción de ADN utilizando Chelex-100 al 5% resultó ser eficaz, dado que a pesar de los bajos valores de los cocientes de absorbancias A260/A280 de las muestras de ADN obtenidas (cuadro 1), las mismas sirvieron de molde en las reacciones de amplificación. Las extracciones de ADN de tejido vegetal proporcionan muestras con contenido elevado de inhibidores como por ejemplo los polifenoles y polisacáridos que se unen al ADN covalentemente (Li et al., 2002), lo cual  hace que se inhiba la reacción de amplificación (PCR). La resina Chelex-100 retiene estos inhibidores favoreciendo la utilización rutinaria de la técnica en los análisis de muestras de tejido vegetal.

El fragmento del gen DKG de 170 pb se ha utilizado como molde en la técnica de Amplificación Isotérmica con Recombinasa y Polimerasa (RPA) para la detección de CLas (Ghosh et al., 2018); sin embargo, en el presente trabajo se utilizaron los oligonucleótidos específicos para el gen DKG en reacciones de PCR y se logró obtener un amplificado de 170 pb. El bajo tamaño del amplificado DKG, posiblemente podría estar promoviendo una mejor amplificación y además mejora la sensibilidad de la prueba de PCR.

El método de extracción de ADN por Chelex-100 permitió la obtención de ADN total de cítricos, con pocos pasos experimentales y reducidas posibilidades de introducción de contaminantes en el proceso de purificación.

Conclusiones

El protocolo descrito permitió obtener ADN genómico no solo de Citrus latifoli sino de Candidatus Liberibacter asiaticus y fue utilizado como molde para el diagnóstico molecular, mediante reacciones de PCR. La extracción de ADN con la resina quelante Chelex-100 Bio-Rad es económica, no utiliza proteinasa K ni reactivos tóxicos. Es una metodología de un único paso que permite la obtención de suficiente cantidad de ADN para ser utilizado en el diagnóstico de CLas y se podría adaptar a diagnósticos masivos de plantaciones de cítricos.

REFERENCIAS BIBLIOGRÁFICAS

Abu Ashfaqur Sajib, A. Islam Bhuiya, M. A., Huque, R. (2017). A Simple, efficient and rapid method for good quality DNA extraction from rice grains. Rice Science, 24 (2), 119-122. https://doi.org/10.1016/j.rsci.2016.09.003

Aminisarteshnizi, M., Mohlabe, M., y Lediga, R. (2022). Evaluation of Chelex 100 for DNA extraction in Tomato Seedling (Solanum lycopersicum). Asian Journal of Plant Sciences, 21, 106-110. https://doi.org/10.3923/ajps.2022.106.110

Butler, J. M. (2005). Forensic DNA Typing: Biology, Technology, and Genetics of STR Markers (2° ed). Elsevier Academic Press.

Das, A. K., y Kumar, A. (2010). First Report of the Huanglongbing Bacterium ‘Candidatus Liberibacter asiaticus’ Infecting Satkara (Citrus macroptera) in India. Plant Disease, 94(3), 375. https://doi.org/10.1094/PDIS-94-3-0375A

Donnua, S., Paradornuwat, A., Chowpongpang, S., y Thaveechai, N. (2012). Comparison between single and duplex conventional PCR for detection of Candidatus Liberibacter asiaticus, the causal agent of citrus Huanglongbing disease. Thailand. Crop Protection, 41, 128-133. https://doi.org/10.1016/j.cropro.2012.04.030

Eismann, C. E., Menegario, A., De Oliveira, E. G., Elias Pallegrini, L., Martins Viana, J. L., Teixeira Zanatta, M. B., Barbiero, L., y Fostier, A. H. (2023). A simple, green and low-cost agarose-based binding layer for simultaneous determination of cations and anions in aquatic systems using DGT. Analytical Methods, 15(27), 3310-3317. https://doi.org/10.1039/d3ay00682d

Fourie, P. H., Kirkman, W., Cook, G., Steyn, C., de Bruyn, R., Bester, R., Roberts R, Bassimba, D. D. M., José, C. M., Maree, H. J. (2020). First report of “Candidatus Liberibacter africanus associated with African Greening of Citrus in Angola. Plant Disease, 105(2), 486-486. https://doi.org/10.1094/PDIS-06-20-1392-PDN

Ghosh, D. K., Kokane, S. B., Kokane, A. D., Warghane, A. J., Motghare, M. R., Bhose, S., Sharma, A. K., y Reddy M. K. (2018). Development of a recombinase polymerase based isothermal amplification combined with lateral flow assay (HLB-RPA-LFA) for rapid detection of “Candidatus Liberibacter asiaticus”. PLoS One, 13(12), 1-23. https://doi.org/10.1371/journal.pone.0208530

Graham, K. A., Gomez, J., Primm, T. P., y Houston, R. (2023). Comparison of nine extraction methods for bacterial identification using the ONT MinION sequencer. International Journal of Legal Medicine, 138, 351-360. https://doi.org/10.1007/s00414-023-03092-0

Hocquellet, A., Toorawa, P., Bové, J. y Garnier, M. (1999). Detection and identification of the two “Candidatus Liberobacter” species associated with citrus huanglongbing by PCR amplification of ribosomal protein genes of the beta operon. Molecular and Cellular Probes, 13(5), 373-379. https://doi.org/10.1006/mcpr.1999.0263

Hu, X., Jiang, N., Li, Y., Zhou, Y., Fan, Y., Xue, M., y Meng, Y. (2022). Rapid nucleic acid extraction for aquatic animal DNA virus determination using Chelex 100 resin via conventional PCR and digital droplet PCR detection. Animals, 12(15). https://doi.org/10.3390/ani12151999

HwangBo, K., Son, S. H., Lee, J. S., Min, S. R., Ko, S. M., Liu, J. R., Choi, D., y Jeong, W. J. (2010) Rapid and simple method for DNA extraction from plant and algal species suitable for PCR amplification using a chelating resin Chelex 100. Plant Biotechnology Reports, 4, 49–52. https://doi.org/10.1007/s11816-009-0117-4

Jagoueix, S., Bove, J. M, y Garnier, M. (1994). The phloem-limited bacterium of greening disease of citrus is a member of the alpha subdivision of the Proteobacteria. International Journal Systematic and Evolutionary Microbiology, 44(3), 379-386. https://doi.org/10.1099/00207713-44-3-379

Keith Hamby, R., Sims, L., Issel, L., y Zimmer, E. (1988). Direct ribosomal RNA sequencing: Optimization of extraction and sequencing methods for work with higher plants. Plant Molecular Biology Reporter, 6(3), 175-192. https://doi.org/10.1007/BF02669591

Li, Y. X., Su, Z. X., y Chen, F. (2002). Rapid Extraction of Genomic DNA From Leaves and Bracts of Dove Tree (Davidia involucrata). Plant Molecular Biology Reporter, 20(2), 185.

Lim, D. H., Jee, H., Moon, K. C., Lim, C. S., y Jang, W. S. (2022). Development of a simple DNA extraction method and Candida Pan loop-mediated isothermal amplification assay for diagnosis of Candidemia. Pathogens, 11(2). https://doi.org/10.3390/pathogens11020111

Lucena-Aguilar, G., Sánchez-López, A. M., Barberán-Aceituno, C., Carrillo-Ávila, J. A., López-Guerrero, J. A., y Aguilar-Quesada, R. (2016) DNA source selection for downstream applications based on DNA quality indicators analysis. Biopreservation and Biobanking, 14(4), 264-70. https://doi.org/10.1089/bio.2015.0064

Marys, E., Rodríguez-Román, E., Mejías, R., Mejías, A., Mago, M., y Hernández, Y. (2020). First report on molecular evidence of Candidatus Liberibacter asiaticus associated with citrus Huanglongbing in Venezuela. Journal of Plant Pathology, 102(4), 1333-1333. https://doi.org/10.1007/s42161-020-00616-0

Neves, C., y Zieger, M. (2023). “Total Human DNA Sampling” – Forensic DNA profiles from large areas. Forensic Science International Genetics, 67, 102939. https://doi.org/10.1016/j.fsigen.2023.102939

Quintana M, de-León L, Cubero J, Siverio F. (2022). Assessment of psyllid handling and DNA extraction methods in the detection of ‘Candidatus Liberibacter Solanacearum’ by qPCR. Microorganisms, 10(6), 1104. https://doi.org/10.3390/microorganisms10061104

Richero, M. (2012). Diagnóstico de HLB por PCR [Archivo PDF]. http://www.inia.uy/Documentos/P%C3%BAblicos/INIA%20Salto%20Grande/2015/2015_09_24%20-%20Jornada%20Citricultura/Dia_02_Presentaciones_PDF/5.1-%20Diagnostico%20de%20HLB%20por%20PCR.pdf

Robles-González, M. M., Velázquez-Monreal, J. J., Manzanilla-Ramirez, M. A., Orozco-Santos, M., Medina-Urrutia, V. M., López-Arroyo, J. I., y Flores-Virgen, R. (2013). Síntomas del Huanglongbing (HLB) en árboles de limón mexicano [Citrus aurantifolia (Christm) Swingle] y su dispersión en el estado de Colima, México. Revista Chapingo. Serie Horticultura, 19(1), 15-31. https://doi.org/10.5154/r.rchsh.2012.01.005

Rodriguez-Riveiro, R., Velasco, A., y Sotelo, C. G. (2022). The influence of DNA extraction methods on species identification results of seafood products. Foods, 11(12). https://doi.org/10.3390/foods11121739

Simon, N., Shallat, J., Wietzikoski, C. W., y Harrington W. E. (2020) Optimization of Chelex 100 resin-based extraction of genomic DNA from dried blood spots. Biology Methods and Protocols, 2(5), 1-20. https://doi.org/10.1093/biomethods/bpaa009

Stacey, J., Isaac, P.G. (2000). Isolation and purification of DNA from plants. En Rapley, R. (eds) The nucleic acid protocols handbook (pp. 13-16). Springer Protocols Handbooks. Humana Press. https://doi.org/10.1385/1-59259-038-1:13

Tao, J., Liu, D., Xiong, J., Dou, L., Zhai, W., Zhang, R., y Wen, K. (2022). Rapid on-site detection of extensively drug-resistant genes in enterobacteriaceae via enhanced recombinase polymerase amplification and lateral flow biosensor. Microbiol Spectrum, 10(6), e0334422. https://doi.org/10.1128/spectrum.03344-22

Xu, D., Liang, J., Zhou, T., Liu, Y., Wang, Q., Mu, X., Yao, L. (2023). First report of powdery mildew caused by Podosphaera fusca

Suscribir
Notificar de
guest

Este sitio usa Akismet para reducir el spam. Aprende cómo se procesan los datos de tus comentarios.

0 Comentarios
Comentarios en línea
Ver todos los comentarios